nativepage bis tris gel system thermo fisher bn1001box chemical compound (Thermo Fisher)

Thermo Fisher is a verified supplier

Thermo Fisher manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Thermo Fisher nativepage bis tris gel system thermo fisher bn1001box chemical compound
Nativepage Bis Tris Gel System Thermo Fisher Bn1001box Chemical Compound, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bn1001box/TRIS-HCL/10__7554_slash_elife__88387-251-297-302
Average 99 stars, based on 1 article reviews

nativepage bis tris gel system thermo fisher bn1001box chemical compound - by Bioz Stars, 2026-10

99/100 stars

Images

Multiplex sample analysis:

Article Title: Identification of long-lived proteins in the mitochondria reveals increased stability of the electron transport chain.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies OxPhos Antibody Cocktail Rodent Invitrogen Cat#458099, RRID: AB_2533835 NDUFA9 Monoclonal Antibody Invitrogen Cat#459100, RRID: AB_2532223 UQCRC1 Monoclonal Antibody Invitrogen Cat#459140, RRID: AB_2532227 COX IV (3E11) Rabbit mAb Cell Signaling Cat#4850S, RRID: AB_2085424 COX7C Polyclonal Antibody Invitrogen Cat#PA551284 RRID: AB_2636731 NDUFA4 Polyclonal Antibody Invitrogen Cat#PA599439, RRID: AB_2818372 COX5A Polyclonal Antibody Proteintech Cat# 11448-1-AP, RRID: AB_2085429 a/b-Tubulin Antibody Cell Signaling Cat#2148S, RRID: AB_2288042 Myc-Tag (9B11) Mouse mAb Cell Signaling Cat# 2276S, RRID: AB_331783 Monoclonal ANTI-FLAG M2 antibody Sigma Cat#F3165, RRID: AB_259529 Goat anti-Mouse IgG2a Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Invitrogen Cat# A21131, RRID: AB_141618 Goat anti-Mouse IgG1 Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 Invitrogen Cat# A21124, RRID: AB_141611 Goat anti-Mouse IgG1 Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Invitrogen Cat# A21121, RRID: AB_2535764 Goat anti-Mouse IgG2a Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 Invitrogen Cat# A21134, RRID: AB_1500825 Chemicals, peptides, and recombinant proteins 15N-spirulina algae Cambridge isotope Laboratories Cat#MF-SPIRULINA-N-S 2.5% Glutaraldehyde Ted Pella Inc., Redding, CA Cat#18426 2% Formaldehyde Ted Pella Inc., Redding, CA Cat#18200 Sodium Cacodylate Ted Pella Inc., Redding, CA Cat#18851 Osmium Tetroxide Electron Microscopy Sciences Cat#19190 Potassium Ferrocyanide Electron Microscopy Sciences Cat#3114 Thiocarbohydrazide Electron Microscopy Sciences Cat#21900 Durcupan ACM Resin Sigma-Aldrich Cat#44611 (Comp A), Cat# 44612 (Comp B), Cat#44613 (Comp C), Cat#44614 (Comp D). .. Matrigel (Cultrex) R&D Systems Cat#3433-005-01 DMEM:F12 for SILAC Fisher Scientific Cat#88370 Dialyzed FBS Gibco Cat#26400044 DMEM for SILAC Fisher Scientific Cat#A33822 L-Lysine-13C6 hydrochloride Sigma Cat#643459 L-Arginine-13C6, 15N4 hydrochloride Sigma Cat#608033 TCEP-HCL Sigma-Aldrich Cat#C4706 Chloroacetamide Sigma-Aldrich Cat#C0267 Trypsin Promega Cat# V5111 NativePAGE Sample Prep Kit Invitrogen Cat#BN2008 Native PAGE 3-12% gradient gel Invitrogen Cat# BN1001BOX Dark Blue Cathode Buffer Invitrogen Cat# BN2002 Running Anode Buffer Invitrogen Cat#BN2001 Trizol Invitrogen Cat#15596026 SuperSignal West Pico Fisher Scientific Cat#PI34078 SYBR Green PCR Master Mix Applied Biosystems Cat#4309155 Ibidi u-Slide chambers Ibidi Cat#80826 (Continued on next page) e1 Developmental Cell 56, 2952–2965.e1–e9, November 8, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER 4-hydroxytamoxifen (4OHT) Sigma-Aldrich Cat#H6278 Critical commercial assays RNeasy Mini Kit Qiagen Cat#74106 QuantiTect Reverse Transcriptase Kit Qiagen Cat#205311 Complex IV Rodent Enzyme Activity Microplate Assay Kit Abcam Cat# ab109911 Seahorse XF Cell Mito Stress Test Agilent Cat#103015-100 Seahorse XF Glycolysis Stress Test Kit Agilent Cat#103020-100 ATP Chemiluminescence Detection Assay Kit Cayman Chemicals Cat# NC1357058 L-Lactate Assay Kit Abcam Cat# ab65330 Deposited data Mass spectrometry Proteomic Datasets ProteomeXchange Consortium via PRIDE (Perez-Riverol et al., 2019) https://doi.org/10.6019/PXD028963 Experimental models: Cell lines SH-SY5Y ATCC Cat#CRL-2266 C2C12 Myoblasts ATCC Cat#CRL-1772 Human ES Cells (H9) WiCell Cat#WA09 Experimental models: Organisms/strains Mouse:FVB (Male) The Jackson Laboratory, Bar Harbor,ME Stock No: 001800 Oligonucleotides COX7C sh1 targeting sequence -TGCT GTTGACAGTGAGCGACCGCACCTTTC TTTATAGTAATAGTGAAGCCACAGAT GTATTACTATAAAGAAAGGTGCGGC TGCCTACTGCCTCGGA This paper Eton Biosciences; Sequences generated using shERWOOD algorithm (Knott et al., 2014) COX7C sh2 targeting sequence - TGCT GTTGACAGTGAGCGCCACCAGCTACTT AAAAAATAATAGTGAAGCCACAGATGTA TTATTTTTTAAGTAGCTGGTGTTGCCTA CTGCCTCGGA This paper Eton Biosciences; Sequences generated using shERWOOD algorithm (Knott et al., 2014) COX7C qPCR Primer: Forward - AGCATGTTGGGCCAGAGT This paper Eton Biosciences COX7C qPCR Primer: ReverseACTGAAAACGGCAAATTCTT This paper Eton Biosciences NDUFA4 qPCR Primer: Forward - CGCTTGGCACTGTTTAATCCA This paper Eton Biosciences NDUFA4 qPCR Primer: Reverse - TCCATGGCTCTGGGTTGTTC This paper Eton Biosciences COX5A qPCR Primer: Forward - CTGCCGCTGTCTGTTCCATTCG This paper Eton Biosciences COX5A qPCR Primer: Reverse - TGTCACCCAGCGAGCATCAAACT This paper Eton Biosciences Beta-actin qPCR Primer: Forward - CTGTCCCTGTATGCCTCTG This paper Eton Biosciences Beta-actin qPCR Primer: Reverse - ATGTCACGCACGATTTCC This paper Eton Biosciences Recombinant DNA UNG Construct Addgene Cat#127288 Plasmid: pRITE Myc to Flag (pRITE-MF) (Toyama et al., 2019) N/A Plasmid: ATP5C1 RITE-MF pLentiCMVBlast This paper N/A (Continued on next page) Developmental Cell 56, 2952–2965.e1–e9, November 8, 2021 e2

Sample Prep:

Clear Native PAGE:

SYBR Green Assay:

Polymerase Chain Reaction:

Membrane:

Article Title: Unveiling the substrate specificity of the ABC transporter Tba and its role in glycopeptide biosynthesis
Article Snippet: 640 641 Jo urn al repro of STAR Methods 642 Key resource table 643 644 REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-FLAG® M2 Sigma-Aldrich F3165 Rabbit polyclonal anti-BirA IgG Thermo-Fisher PA5-80251 goat anti-Mouse IgG DyLightTM 800 Thermo-Fisher SA5-35521 goat anti-Rabbit IgG DyLightTM 800 Thermo-Fisher SA5-35571 Streptavidin DyLightTM 800 Thermo-Fisher 21851 Bacterial and virus strains See Table S5 in the SI This work Biological samples Chemicals, peptides, and recombinant proteins Q5® Hot Start High-Fidelity DNA Polymerase NEB M0491L Phusion® High-Fidelity DNA Polymerase Thermo-Fisher F-530XL Taq DNA Polymerase Thermo-Fisher EP0401 NdeI Thermo-Fisher ER0585 XbaI Thermo-Fisher ER0683 KpnI Thermo-Fisher ER0522 Apramycin Genaxxon M3450.0005 Ampicillin Roth K029.4 Erythromycin Roth 4166.2 Critical commercial assays Deposited data MD simulation trajectories, interaction data and MD quality control data, representative PDB files from the alphaFold models and phylogenetic trees This work 10.5281/zenodo.7 547342 10.5281/zenodo.7 732071 10.5281/zenodo.7 547403 RNA-Seq Illumina read files as well as the raw counts This work GSE274067 Mass spectrometry proteomics data This work PXD054387 Metabolomics raw data This work 10.5281/zenodo.1 4918266 Experimental models: Cell lines Experimental models: Organisms/strains Jo urn al Pr e-p roo f Oligonucleotides See Table S4 for cloning primers This work Recombinant DNA See Table S6 for plasmids This work Software and algorithms AlphaFold (v2.2.2)/Alphafold3 Jumper, J. et al. 26 Desmond Bowers, K. J. et al. 74 OPLS4 force-field Lu, C. et al. 75 Glide Friesner, R. A. et al. 71 LigPrep Shelley, J. C. et al. 69 Maestro (v2022.4) www.schrodinger.com prokka (v1.14.16) Seemann, T. 48 OrthoFinder platform (v2.3.11) Emms, D. M. & Kelly, S. 49 blastP https://blast.ncbi.nlm.nih.g ov/ scipy (v1.9.3) Virtanen, P. et al. 50 ΔG prediction server (v1.0) Hessa, T. et al. 19 MEGAX (v10.2.4) Kumar, S. et. al. 51 MUSCLE algorithm Edgar, R. C. 53 iTOL (v6.6) Letunic, I. .. & Bork, P. 55 Other Serva, NativePAGETM 3 to 12% (Bis-Tris, 1.0 mm, Mini Protein Gels) Thermo-Fisher BN1001BOX Immun-Blot® polyvinylidene difluoride (PVDF) membrane (0.2 μm) Bio-Rad #1620177 645 646 647 Experimental model and study participant details 648 The bacterial strains and plasmids used in this study are described with the necessary 649 information in Table S5 and Table S6. ..

Review